DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_040636c
Line Availability available from NASC (N665838) and ABRC (SALK_040636c)
Confirmed for Hit At3g10620
Parent of DUPLO pair 2408
Parent of pair(s) none

Gene hit At3g10620

 
Sequence (A. th genome BLAST matches underlined)
CTCCAGCCTGCCCTTCCTTCATCGCTGCCGGAAGTCTCGGGTCTCCTCCTCCTCCGCTCG
GTGTTGTTCTTCCATGGAATCTCCTCCTGAAGGATACAGAAGAAATGTCGGCGTCTGCCT
CATGAATT
GenBank Accession ED586042 [GenBank]
Graphic View Graphic view of gene At3g10620
Predicted Position of Insertion Chr3:3320355 - go to primer design
BLAST e Value 1e-64
Hit Clone Code (BAC ID) F13M14
Hit Gene Code At3g10620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nudix hydrolase homolog 26
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37