DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_041461c |
Line Availability | available from NASC (N658204) and ABRC (SALK_041461c) |
Confirmed for Hit | At2g28725 |
Parent of DUPLO pair | 11876 |
Parent of pair(s) | none |
Gene hit At1g28660
Sequence (A. th genome BLAST matches underlined) | TGGTACAGTGGATACATAAAAGGAGCAGTTAGAATT |
GenBank Accession | BH750521 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr1:10071874 - go to primer design |
BLAST e Value | 6e-13 |
Hit Clone Code (BAC ID) | F1K23 |
Hit Gene Code | At1g28660 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | GDSL-like Lipase/Acylhydrolase superfamily protein |
Insertion Classification | CDSi |
Confirmation Status | unknown |
Gene hit At2g28725
Sequence (A. th genome BLAST matches underlined) | ATGACCATAACTCCTGCGCAATATCGTTGGTAAAAAAACGTCTAAATATGAATT |
GenBank Accession | ED586535 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr2:12328870 - go to primer design |
BLAST e Value | 4e-06 |
Hit Clone Code (BAC ID) | T11P11 |
Hit Gene Code | At2g28725 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | forkhead box protein G1 |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |