DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_045266
Line Availability available from NASC (N545266) and ABRC (SALK_045266)
Confirmed for Hit At3g25585
Parent of DUPLO pair none
Parent of pair(s) 2541

Gene hit At3g25585

 
Sequence (A. th genome BLAST matches underlined) 
CAACTTCAGTCATTCATGAGATCACAACTGCACTTGGAATCTACTGCTTCAGGTTAGAAT
TAAGATTAAGATACTCTTTCTTCTTACCATTTTATTGTTTTAAGTTTACAAAATTTGACA
AGATTAATCTGTTTTTTTTCATCAGGATTACTCGGAAAGAAGCT
GenBank Accession ED587828 [GenBank]
Graphic View Graphic view of gene At3g25585
Predicted Position of Insertion Chr3:9298105 - go to primer design
BLAST e Value 4e-74
Hit Clone Code (BAC ID) MWL2
Hit Gene Code At3g25585 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation aminoalcoholphosphotransferase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37