DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_047220c
Line Availability available from NASC (N682312) and ABRC (SALK_047220c)
Confirmed for Hit At4g31930
Parent of DUPLO pair 6803
Parent of pair(s) none

Gene hit At4g31930

 
Sequence (A. th genome BLAST matches underlined)
TACATTTAAAGTGATTCAAGAAAGCAGAGAGATTAGTAGTAAGTACCCAAAATTAGGTCC
CATGTAAGGCTGACCAGTGATTTTGTTGCGTCTAAGCT
GenBank Accession BH789883 [GenBank]
Graphic View Graphic view of gene At4g31930
Predicted Position of Insertion Chr4:15449969 - go to primer design
BLAST e Value 2e-49
Hit Clone Code (BAC ID) F11C18
Hit Gene Code At4g31930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mitochondrial glycoprotein family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37