DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_048387c
Line Availability available from NASC (N671415) and ABRC (SALK_048387c)
Confirmed for Hit At1g62960
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g62960

 
Sequence (A. th genome BLAST matches underlined) 
TTCGAATTTTATTTTCTTTTAACCTAAAAATCAAAACTCTTCTCTTTCTCTTTCAAATCT
CTTCGCCGTCGGACTCAATTATCCGTTAACCCGACCCGTTAAAAAACCTTCAAAGTGGCT
CCGATTTTGATTTCAAACACTAAAATATTTATTTACCTAAAAACATGAGTTCACTACAAT
GACCCGTACCGAACCAAACCGGAGCCGGAGCTCCAATTCCGATTCCGATAAGAATT
GenBank Accession BH755086 [GenBank]
Graphic View Graphic view of gene At1g62960
Predicted Position of Insertion Chr1:23320407 - go to primer design
BLAST e Value 1e-131
Hit Clone Code (BAC ID) F16P17
Hit Gene Code At1g62960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ACC synthase 10
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH755086 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37