DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_049540c
Line Availability available from NASC (N653821) and ABRC (SALK_049540c)
Confirmed for Hit At3g50410
Parent of DUPLO pair 12587
Parent of pair(s) none

Gene hit At3g50410

 
Sequence (A. th genome BLAST matches underlined)
GCGGGAACGTTTCGCGCTTTTACGAGTACCACCACCGACAGGAACGTCACGGAGAGTACC
ACCGTGAGTCCAGTAACGACGACAAGCT
GenBank Accession ED588847 [GenBank]
Graphic View Graphic view of gene At3g50410
Predicted Position of Insertion Chr3:18710132 - go to primer design
BLAST e Value 2e-43
Hit Clone Code (BAC ID) F11C1
Hit Gene Code At3g50410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation OBF binding protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37