DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_050243c
Line Availability available from NASC (N678466) and ABRC (SALK_050243c)
Confirmed for Hit At4g00390
Parent of DUPLO pair 6889
Parent of pair(s) none

Gene hit At4g00390

 
Sequence (A. th genome BLAST matches underlined) 
CGCACACTCTTATCCAACATAGCCTCAAGCTCTTTAGCTTGCATCAACTGAAACTTCTCT
TCAACAATCTTCTTAGTCTCAAGAGTAAACGAACTCCATTTCTGCCTCACATAATACTCA
TCAATACCCGAACCAGCAATCATCCTAGCAAGAGACGACTTCTCAAACCAATCATCTCCA
TTAGTTGAAGAA
GenBank Accession BH751519 [GenBank]
Graphic View Graphic view of gene At4g00390
Predicted Position of Insertion Chr4:171696 - go to primer design
BLAST e Value 1e-105
Hit Clone Code (BAC ID) F5I10
Hit Gene Code At4g00390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNA-binding storekeeper protein-related transcriptional regulator
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37