DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_054396
Line Availability available from NASC (N554396) and ABRC (SALK_054396)
Confirmed for Hit At1g73570
Parent of DUPLO pair 190
Parent of pair(s) none

Gene hit At1g73570

 
Sequence (A. th genome BLAST matches underlined)
AAGGAAAAGAGTTAGTATGGTCGCATTACCTTCTTCCAACATCCCATTCTCTACCCATTC
CACCACCTTTTGATGCACTTCTGGTAAGGAATT
GenBank Accession BH790053 [GenBank]
Graphic View Graphic view of gene At1g73570
Predicted Position of Insertion Chr1:27653828 - go to primer design
BLAST e Value 2e-46
Hit Clone Code (BAC ID) F6D5
Hit Gene Code At1g73570 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation HCP-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37