DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_054530c
Line Availability available from NASC (N658693) and ABRC (SALK_054530c)
Confirmed for Hit At1g07180
Parent of DUPLO pair 2806
Parent of pair(s) none

Gene hit At1g07180

 
Sequence (A. th genome BLAST matches underlined) 
TACGGTCCCTTAGTCTGGTCAACTGGTGTTGGTCCATCTTCATTTGTGAGGTCTCTTGAT
TTTCCTAAAGATCCAGGTGGAAGGTATGTTAGTTCCAATGTCACAACAGAAAGCT
GenBank Accession BH790104 [GenBank]
Graphic View Graphic view of gene At1g07180
Predicted Position of Insertion Chr1:2205967 - go to primer design
BLAST e Value 2e-59
Hit Clone Code (BAC ID) F10K1
Hit Gene Code At1g07180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alternative NAD(P)H dehydrogenase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37