DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_061534c
Line Availability available from NASC (N666214) and ABRC (SALK_061534c)
Confirmed for Hit At2g45920
Parent of DUPLO pair 2723
Parent of pair(s) none

Gene hit At2g45920

 
Sequence (A. th genome BLAST matches underlined) 
GGCAATGGCAATAGCTTATGTGAGATTCCAAGAAGATGTTACCCTTTTGATTGCTTCATT
TTTCTCTTTTACAACTTCTTGATGCTTGAAAGCCTCCAAGCT
GenBank Accession ED591976 [GenBank]
Graphic View Graphic view of gene At2g45920
Predicted Position of Insertion Chr2:18900433 - go to primer design
BLAST e Value 1e-51
Hit Clone Code (BAC ID) F4I18
Hit Gene Code At2g45920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation U-box domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED591976 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37