DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_064700c |
Line Availability | available from NASC (N675581) and ABRC (SALK_064700c) |
Confirmed for Hit | At4g28470 |
Parent of DUPLO pair | 750 |
Parent of pair(s) | none |
Gene hit At4g28470
Sequence (A. th genome BLAST matches underlined) | GGTGAGTTATCTTTTCGCCACTCATGGTTGA |
GenBank Accession | BH792555 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr4:14068105 - go to primer design |
BLAST e Value | 4e-10 |
Hit Clone Code (BAC ID) | F20O9 |
Hit Gene Code | At4g28470 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | 26S proteasome regulatory subunit S2 1B |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |