DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_064700c |
| Line Availability | available from NASC (N675581) and ABRC (SALK_064700c) |
| Confirmed for Hit | At4g28470 |
| Parent of DUPLO pair | 750 |
| Parent of pair(s) | none |
Gene hit At4g28470
| Sequence (A. th genome BLAST matches underlined) | GGTGAGTTATCTTTTCGCCACTCATGGTTGA |
| GenBank Accession | BH792555 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr4:14068105 - go to primer design |
| BLAST e Value | 4e-10 |
| Hit Clone Code (BAC ID) | F20O9 |
| Hit Gene Code | At4g28470 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | 26S proteasome regulatory subunit S2 1B |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 