DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_065067c
Line Availability available from NASC (N686145) and ABRC (SALK_065067c)
Confirmed for Hit At5g42010
Parent of DUPLO pair none
Parent of pair(s) 7936

Gene hit At5g42010

 
Sequence (A. th genome BLAST matches underlined)
AGCCATGAACGTCCTGGCACGCGCTTTTTTCCAGCCTCAGCGTAGATCTGCTGCGGACTG
CAGCTGAAACCGCTGCTGCGGCCGTACCTGCTACTAATCCAAGCT
GenBank Accession BH792806 [GenBank]
Graphic View Graphic view of gene At5g42010
Predicted Position of Insertion Chr5:16804662 - go to primer design
BLAST e Value 7e-25
Hit Clone Code (BAC ID) MJC20
Hit Gene Code At5g42010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37