DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_068598
Line Availability available from NASC (N568598) and ABRC (SALK_068598)
Confirmed for Hit At1g20460
Parent of DUPLO pair 11944
Parent of pair(s) none

Gene hit At1g20460

 
Sequence (A. th genome BLAST matches underlined)
TGACGAAGACTACAACATCCACCCTGGATCAAACGATATAGAAGCT
GenBank Accession BH848612 [GenBank]
Graphic View Graphic view of gene At1g20460
Predicted Position of Insertion Chr1:7092808 - go to primer design
BLAST e Value 2e-16
Hit Clone Code (BAC ID) F5M15
Hit Gene Code At1g20460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NADH-ubiquinone oxidoreductase chain
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37