DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_093820c
Line Availability available from NASC (N682665) and ABRC (SALK_093820c)
Confirmed for Hit At1g22882
Parent of DUPLO pair 12338
Parent of pair(s) none

Gene hit At1g22882

 
Sequence (A. th genome BLAST matches underlined)
GGCATCCACACCGTAGACTTCTATTAAACTCAAGGTGCAGTAGAATT
GenBank Accession ED599582 [GenBank]
Graphic View Graphic view of gene At1g22882
Predicted Position of Insertion Chr1:8100443 - go to primer design
BLAST e Value 2e-19
Hit Clone Code (BAC ID) F19G10
Hit Gene Code At1g22882 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Galactose-binding protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37