DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_096324c
Line Availability available from NASC (N676287) and ABRC (SALK_096324c)
Confirmed for Hit At4g29360
Parent of DUPLO pair none
Parent of pair(s) 7941

Gene hit At4g29360

 
Sequence (A. th genome BLAST matches underlined)
AAAGAGGATTTGAGTGTAAAGATATATTGAAAAAGGAAAGAATGGAGATAAAAATGAAGA
AGAATAGATTTAGTNTTTGA
GenBank Accession ED600977 [GenBank]
Graphic View Graphic view of gene At4g29360
Predicted Position of Insertion Chr4:14453603 - go to primer design
BLAST e Value 2e-15
Hit Clone Code (BAC ID) F17A13
Hit Gene Code At4g29360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-Glycosyl hydrolases family 17 protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37