DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_103154c
Line Availability available from NASC (N658006) and ABRC (SALK_103154c)
Confirmed for Hit At1g76760
Parent of DUPLO pair 345
Parent of pair(s) none

Gene hit At1g76760

 
Sequence (A. th genome BLAST matches underlined) 
TATTTTGTTCAATTCTAGCTTACTTAATTTTACCCTATGAATTATTGAATTGAATGGAAA
CTTTAAGTCTCCGGTTCGAACCCGACGAACCGGAAACTGAAATTTGACGGCCGAGATAGA
ACGAGAAGCGAAAGCAGAAACACCTGACGATTCTTTCGAATT
GenBank Accession BH903678 [GenBank]
Graphic View Graphic view of gene At1g76760
Predicted Position of Insertion Chr1:28812798 - go to primer design
BLAST e Value 1e-55
Hit Clone Code (BAC ID) F28O16
Hit Gene Code At1g76760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation thioredoxin Y1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37