DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_104317c
Line Availability available from NASC (N661063) and ABRC (SALK_104317c)
Parent of DUPLO pair 7967
Parent of pair(s) none

Gene hit At1g52770

 
Sequence (A. th genome BLAST matches underlined)
TTCTTAACCAACCGACTCATGAGCTCGACATCGAGCAATGTCCCACACGTGTGACTAAAG
GAAGGTATCATTAGCTCCTTGAGTGAAGCT
GenBank Accession BH904329 [GenBank]
Graphic View Graphic view of gene At1g52770
Predicted Position of Insertion Chr1:19656562 - go to primer design
BLAST e Value 3e-42
Hit Clone Code (BAC ID) F14G24
Hit Gene Code At1g52770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phototropic-responsive NPH3 family protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37