DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_122023c
Line Availability available from NASC (N670088) and ABRC (SALK_122023c)
Confirmed for Hit At2g01800
Parent of DUPLO pair 12496
Parent of pair(s) none

Gene hit At2g01800

 
Sequence (A. th genome BLAST matches underlined) 
AAAGTGGTGGAGGGAAATGTCACTAAGATGGGAGAGAATCAGCATATTTGTGATGCAGAT
CAAGAGGGACCTGTCAATGGTCATACCATTGATGTTGAGGTCAAGCT
GenBank Accession BZ353697 [GenBank]
Graphic View Graphic view of gene At2g01800
Predicted Position of Insertion Chr2:344570 - go to primer design
BLAST e Value 6e-50
Hit Clone Code (BAC ID) T8O11
Hit Gene Code At2g01800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation COP1-interacting protein-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37