DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_130880c |
Line Availability | available from NASC (N654399) and ABRC (SALK_130880c) |
Confirmed for Hit | At5g41090 |
Parent of DUPLO pair | 1386 |
Parent of pair(s) | none |
Gene hit At5g41090
Sequence (A. th genome BLAST matches underlined) | ACTTTGGCTACTTCTTTCTTGCGTGACAAGCT |
GenBank Accession | BZ357532 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr5:16446000 - go to primer design |
BLAST e Value | 1e-10 |
Hit Clone Code (BAC ID) | MEE6 |
Hit Gene Code | At5g41090 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | NAC domain containing protein 95 |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |