DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_136802c
Line Availability available from NASC (N655985) and ABRC (SALK_136802c)
Confirmed for Hit At3g23390
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g23390

 
Sequence (A. th genome BLAST matches underlined)
CGAAAGAGAAGAAACAATTTACCATTTTCGCGTCTCTGATCTCCGGGGAAGCT
GenBank Accession BZ766108 [GenBank]
Graphic View Graphic view of gene At3g23390
Predicted Position of Insertion Chr3:8375451 - go to primer design
BLAST e Value 2e-20
Hit Clone Code (BAC ID) MLM24
Hit Gene Code At3g23390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Zinc-binding ribosomal protein family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37