DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_013055c
Line Availability available from NASC (N667805) and ABRC (SALK_013055c)
Confirmed for Hit At1g05900
Parent of DUPLO pair 2694
Parent of pair(s) none

Gene hit At1g05900

 
Sequence (A. th genome BLAST matches underlined) 
GTTATGTGCTCTTTAGTCTGACTTGAAAGAAGTGTTCCTATGAGCACATAAAATCGCCTT
TCCTAGAAATAGGGAGAGATAAGATCAAAAGGAAAAACAAGAAGGGAAACCTTCCATCGA
CCTTTCAAGGAAGCAAGAATT
GenBank Accession ED573378 [GenBank]
Graphic View Graphic view of gene At1g05900
Predicted Position of Insertion Chr1:1788283 - go to primer design
BLAST e Value 8e-75
Hit Clone Code (BAC ID) T20M3
Hit Gene Code At1g05900 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation endonuclease III 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37