DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_016240c
Line Availability available from NASC (N673931) and ABRC (SALK_016240c)
Confirmed for Hit At5g54590
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g54590

 
Sequence (A. th genome BLAST matches underlined) 
TTTTGCTCACATATGCATCTCTAATGCACATAGAAAACGTCCTAACATGAGGGACATTGT
TCAGGTTTTGACTCGTGTTATTAAAGTGAGACATTGCAGAAAGCGGCAGAAGAATT
GenBank Accession ED575958 [GenBank]
Graphic View Graphic view of gene At5g54590
Predicted Position of Insertion Chr5:22182434 - go to primer design
BLAST e Value 4e-48
Hit Clone Code (BAC ID) MRB17
Hit Gene Code At5g54590 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit queueing for submission to ENA/GenBank


Last Updated on Thursday, 10 June 2021 13:37