DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_016556c
Line Availability available from NASC (N678152) and ABRC (SALK_016556c)
Confirmed for Hit At1g70440
Parent of DUPLO pair 12229
Parent of pair(s) none

Gene hit At1g70440

 
Sequence (A. th genome BLAST matches underlined) 
CACGAATTTACACTACGGCGACGTCATCTACCCCATCTCCGACAACGCACCTAACTTCTC
CGGCGATGCAACGATTCTTCTCCGTGAAGCCACCTTCGAACACGACCTCATCAAAAACTG
TTTCCTCTCCGGGATGGGCTCTTTCTCCACCGAAACGACTATCGTCACCGTACGAAAAAT
CTTACCGCAGAGATTA
GenBank Accession BH857643 [GenBank]
Graphic View Graphic view of gene At1g70440
Predicted Position of Insertion Chr1:26550482 - go to primer design
BLAST e Value 7e-79
Hit Clone Code (BAC ID) F17O7
Hit Gene Code At1g70440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation similar to RCD one 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37