DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_021474c
Line Availability available from NASC (N658549) and ABRC (SALK_021474c)
Confirmed for Hit At3g45000
Parent of DUPLO pair 2757
Parent of pair(s) none

Gene hit At3g45000

 
Sequence (A. th genome BLAST matches underlined)
CTCAAAAATTGGATCTTTAATCTAAAACCCTAAACCCATCAATATAAATCATCATATAAC
TAACTAAATTCCTCAAATTTCGAAACTTTCCTAAGAATCTGATCAAATACAAGAGAAAAA
AGCAACAAGAACCTCGAATTTGTCGTTCAATGTCACGGACATCTTATCGTAGCTTTCGTT
GCCAATCTCGAAGCTGATNNNTNNCTTTCTTACTTCTTGAAACTTTTGATTTTGCAATTC
CAAAAGCT
GenBank Accession BZ288091 [GenBank]
Graphic View Graphic view of gene At3g45000
Predicted Position of Insertion Chr3:16460346 - go to primer design
BLAST e Value 1e-107
Hit Clone Code (BAC ID) F14D17
Hit Gene Code At3g45000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SNF7 family protein
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37