DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_023726c
Line Availability available from NASC (N658565) and ABRC (SALK_023726c)
Confirmed for Hit At5g45430
Parent of DUPLO pair 1585
Parent of pair(s) none

Gene hit At5g45430

 
Sequence (A. th genome BLAST matches underlined) 
CAACAAACCTGTGAGAAGTTATAACGTTAAAGATTCAAAGTATAGACCACCGGGAAGGAA
GAGTCCACGTAAGTAAAATTCACATCTTTTGCCTTCACAAAGATTTTTTTTTAATCATCT
AAATGAATGAATT
GenBank Accession BZ290303 [GenBank]
Graphic View Graphic view of gene At5g45430
Predicted Position of Insertion Chr5:18411355 - go to primer design
BLAST e Value 5e-54
Hit Clone Code (BAC ID) MFC19
Hit Gene Code At5g45430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37