DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_024971c |
| Line Availability | available from NASC (N678259) and ABRC (SALK_024971c) |
| Confirmed for Hit | At5g13120 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | none |
Gene hit At5g13120
| Sequence (A. th genome BLAST matches underlined) | TTGAGAAGGGCAATGTGAGTTTTTCTGGCTGAATT |
| GenBank Accession | BZ661500 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr5:4164017 - go to primer design |
| BLAST e Value | 2e-12 |
| Hit Clone Code (BAC ID) | T19L5 |
| Hit Gene Code | At5g13120 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | cyclophilin 20-2 |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 