DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_035172
Line Availability available from NASC (N535172) and ABRC (SALK_035172)
Confirmed for Hit At1g26620
Parent of DUPLO pair 267
Parent of pair(s) none

Gene hit At1g26620

 
Sequence (A. th genome BLAST matches underlined) 
AGAGAAAAGAGACCAAGTAGAGAATCCCTATGGGAATCCCACTCAGGCCTACCACATCTT
GCTTGAGCTCTTCTAGGCTGGATAATGCATGTATCTTCCACTTTCACATACTCTGGGACT
AATGGCTCTGGCATGTACCCCTCCTCCTTTGTCACCTG
GenBank Accession BH754002 [GenBank]
Graphic View Graphic view of gene At1g26620
Predicted Position of Insertion Chr1:9196133 - go to primer design
BLAST e Value 7e-23
Hit Clone Code (BAC ID) T1K7
Hit Gene Code At1g26620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation T-box transcription factor, putative (DUF863)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37