DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_036965c
Line Availability available from NASC (N662122) and ABRC (SALK_036965c)
Confirmed for Hit At4g26430
Parent of DUPLO pair 2140
Parent of pair(s) none

Gene hit At4g26430

 
Sequence (A. th genome BLAST matches underlined) 
TTTGCATCACTGATTGTCTTATTGTTTTATAGATTATAATCTTGCTAATCCTGTCTTTTT
GATTGTTTTCAAAATTTGAAGAATTTCATGTCATTGATGGAATT
GenBank Accession BH747854 [GenBank]
Graphic View Graphic view of gene At4g26430
Predicted Position of Insertion Chr4:13355891 - go to primer design
BLAST e Value 6e-53
Hit Clone Code (BAC ID) M3E9
Hit Gene Code At4g26430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation COP9 signalosome subunit 6B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37