DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_042239
Line Availability available from NASC (N542239) and ABRC (SALK_042239)
Confirmed for Hit At1g11990
Parent of DUPLO pair none
Parent of pair(s) 2767, 95617

Gene hit At1g11990

 
Sequence (A. th genome BLAST matches underlined) 
GCTACTGATGCTTTCGCGTAGGTAAATATATTCTTCACACACCAATCTGTATCCTTCCTA
ATTCTCAATAAGCTTGTTTTGTTCCTTTTATAGCGAATGCGTGATAACCGTTATTGCAAT
GGTTTTCATTTTGA
GenBank Accession CC053327 [GenBank]
Graphic View Graphic view of gene At1g11990
Predicted Position of Insertion Chr1:4048406 - go to primer design
BLAST e Value 2e-35
Hit Clone Code (BAC ID) F12F1
Hit Gene Code At1g11990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-fucosyltransferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37