DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_047462
Line Availability available from NASC (N547462) and ABRC (SALK_047462)
Confirmed for Hit At4g33910
Parent of DUPLO pair none
Parent of pair(s) 6845

Gene hit At4g33910

 
Sequence (A. th genome BLAST matches underlined) 
ACATTCTCAACCTGGGTTTAACAGGAGGCACATTCTGATCCCAAACATAGAACCCTCGAT
TAGTCACAAAACCAAGCTAAAGACTCCAATCACATCTAAAGAGTACAGAGTAAAAGATCA
GAG
GenBank Accession BH749213 [GenBank]
Graphic View Graphic view of gene At4g33910
Predicted Position of Insertion Chr4:16258367 - go to primer design
BLAST e Value 9e-62
Hit Clone Code (BAC ID) F17I5
Hit Gene Code At4g33910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37