DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_051134c |
Line Availability | available from NASC (N680874) and ABRC (SALK_051134c) |
Confirmed for Hit | At1g65540 |
Parent of DUPLO pair | 1419 |
Parent of pair(s) | none |
Gene hit At1g65540
Sequence (A. th genome BLAST matches underlined) | ATGATGAGGAAGACGCTAGGAAAGCT |
GenBank Accession | ED589270 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr1:24363017 - go to primer design |
BLAST e Value | 3e-07 |
Hit Clone Code (BAC ID) | F5I14 |
Hit Gene Code | At1g65540 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | LETM1-like protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |