DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_053373c
Line Availability available from NASC (N685957) and ABRC (SALK_053373c)
Confirmed for Hit At1g16270
Parent of DUPLO pair 11868
Parent of pair(s) none

Gene hit At1g16270

 
Sequence (A. th genome BLAST matches underlined) 
CTGGACGTGGAAGTATTTTCCCACCAAAGCTACAAAGGACTTTAACCTTTGCTGTTAAAC
TACCTGAGGCTGAAGAAGATGCATATCCATGGAAATTTCCTAAACTTCTATCTTGACATA
ATGAAGCT
GenBank Accession BH756241 [GenBank]
Graphic View Graphic view of gene At1g16270
Predicted Position of Insertion Chr1:5564427 - go to primer design
BLAST e Value 4e-67
Hit Clone Code (BAC ID) F3O9
Hit Gene Code At1g16270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37