DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_073285c
Line Availability available from NASC (N655615) and ABRC (SALK_073285c)
Confirmed for Hit At1g76870
Parent of DUPLO pair 12249
Parent of pair(s) none

Gene hit At1g76870

 
Sequence (A. th genome BLAST matches underlined) 
AGATGTTTACAGCTCATGATTCTCCTAACTACATCTTTCTCGGTCTCATCCAAGTTATCA
ATCTTATCCATGAGCGAAGGACCCTCAACGACCTCCCTAGAAGTTCCTCTACCAAGAATC
TCAT
GenBank Accession BH851631 [GenBank]
Graphic View Graphic view of gene At1g76870
Predicted Position of Insertion Chr1:28857839 - go to primer design
BLAST e Value 2e-31
Hit Clone Code (BAC ID) F7O12
Hit Gene Code At1g76870 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transcription factor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37