DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_085678
Line Availability available from NASC (N585678) and ABRC (SALK_085678)
Confirmed for Hit At1g64990
Parent of DUPLO pair 12724
Parent of pair(s) none

Gene hit At1g64990

 
Sequence (A. th genome BLAST matches underlined) 
AAATATTGGAATCGGAGGTGGAAGCCTTAATAGTGAGCTGTCCAAACAGATATTTTTGGA
AGTGATATAAGCTGCGTCAAGCAAAGGATTAACTTTCAGCTGCCTTGGTTTTTGATTC
GenBank Accession CC055110 [GenBank]
Graphic View Graphic view of gene At1g64990
Predicted Position of Insertion Chr1:24142120 - go to primer design
BLAST e Value 9e-28
Hit Clone Code (BAC ID) F13O11
Hit Gene Code At1g64990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GPCR-type G protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37