DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_085866c
Line Availability available from NASC (N653580) and ABRC (SALK_085866c)
Confirmed for Hit At1g03880
Parent of DUPLO pair none
Parent of pair(s) 1658, 3553, 9748

Gene hit At1g03880

 
Sequence (A. th genome BLAST matches underlined) 
AATCGCAAAATCTATTAGTTTATCTTGCCAAATCAAATTATTGCATATGTCACATAAAAT
TAA
GenBank Accession BH901723 [GenBank]
Graphic View Graphic view of gene At1g03880
Predicted Position of Insertion Chr1:987370 - go to primer design
BLAST e Value 1e-28
Hit Clone Code (BAC ID) F21M11
Hit Gene Code At1g03880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cruciferin 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH901723 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37