DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_086131
Line Availability available from NASC (N586131) and ABRC (SALK_086131)
Confirmed for Hit At5g45710
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g45710

 
Sequence (A. th genome BLAST matches underlined) 
TAGCGAAGACTCTCACTGTTCAATCTGCTCTCCGTGCGAACTGCTTGAAGGAANACAGTT
CTCTTGAAATCTTCTTTTTCTTCGCCCATGGTGTGCGAGGTTTAATGAAAGTCCTGGTTT
TCCCAAAACCTGTGATACATATGCCACTATTGATTTCTGATGATGTTCCATATGTGGTAA
CCGATCT
GenBank Accession BZ595116 [GenBank]
Graphic View Graphic view of gene At5g45710
Predicted Position of Insertion Chr5:18542346 - go to primer design
BLAST e Value 5e-55
Hit Clone Code (BAC ID) MRA19
Hit Gene Code At5g45710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation winged-helix DNA-binding transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37