DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_088888c
Line Availability available from NASC (N656737) and ABRC (SALK_088888c)
Confirmed for Hit At5g40430
Parent of DUPLO pair 2765
Parent of pair(s) none

Gene hit At5g40430

 
Sequence (A. th genome BLAST matches underlined) 
CATCGATAAAAGTGTCATATACATACAATAATAAGAGAATGATTTACGTATATGTGATTT
CAGAAAACTACTTGGAGTGAAGAAGAAGATCAAATACTAATTGAAGTACACAAAGTAATT
GGTGC
GenBank Accession ED598187 [GenBank]
Graphic View Graphic view of gene At5g40430
Predicted Position of Insertion Chr5:16176948 - go to primer design
BLAST e Value 6e-63
Hit Clone Code (BAC ID) MPO12
Hit Gene Code At5g40430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 22
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37