DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_108664 |
| Line Availability | available from NASC (N608664) and ABRC (SALK_108664) |
| Confirmed for Hit | T10K17 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | none |
Gene hit At3g57840
| Sequence (A. th genome BLAST matches underlined) | ATGGGTTCCCATAGAAAAGTGATAATGGTTGTGATACTAT |
| GenBank Accession | BZ378691 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr3:21422823 - go to primer design |
| BLAST e Value | 4e-08 |
| Hit Clone Code (BAC ID) | T10K17 |
| Hit Gene Code | At3g57840 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Plant self-incompatibility protein S1 family |
| Insertion Classification | CDSi |
| Confirmation Status | failed |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 