DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_110010c
Line Availability available from NASC (N667018) and ABRC (SALK_110010c)
Confirmed for Hit At3g57070
Parent of DUPLO pair 8972
Parent of pair(s) none

Gene hit At3g57070

 
Sequence (A. th genome BLAST matches underlined) 
GTTTTTAGTTTCTTTGCTCTTTCTGGTTTCTTTGCTCCTTCTGAGATTGTTTGGTTATCT
CTGGGAATGATAGAGAACAGAGAGAGAAAAGAGAAAGGTGGAGAATAGCTGTCTAGGGCA
GTTGAAGGTGGAAGATGGTGAAATTTAATGGCAGAAGAAAGAAACGATGTTGATGTTGAT
TTTCGGACACAACAACAGTTCTCGATTTGATTTTGATTGTGTAACCAAAGCT
GenBank Accession BZ664712 [GenBank]
Graphic View Graphic view of gene At3g57070
Predicted Position of Insertion Chr3:21124132 - go to primer design
BLAST e Value 1e-111
Hit Clone Code (BAC ID) F24I3
Hit Gene Code At3g57070 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Glutaredoxin family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37