DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_119557c
Line Availability available from NASC (N681651) and ABRC (SALK_119557c)
Parent of DUPLO pair 2759
Parent of pair(s) none

Gene hit At3g57140

 
Sequence (A. th genome BLAST matches underlined)
CCTGATCGTCCCCGTCTTCCGACGCCGAGCTCTCTCCGCCTATAATGACCTTTTCCGGCG
AATCAAGTTGCACGCTTTCCGGAGTCTCCGGAATTTCACTTTCGATTTGGCTATCTTCCG
GATCTGAATT
GenBank Accession BZ352956 [GenBank]
Graphic View Graphic view of gene At3g57140
Predicted Position of Insertion Chr3:21150768 - go to primer design
BLAST e Value 1e-51
Hit Clone Code (BAC ID) F24I3
Hit Gene Code At3g57140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sugar-dependent 1-like protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37