DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_133861c
Line Availability available from NASC (N654018) and ABRC (SALK_133861c)
Confirmed for Hit At1g62950
Parent of DUPLO pair 2607
Parent of pair(s) none

Gene hit At1g62950

 
Sequence (A. th genome BLAST matches underlined) 
ATTTCCCAATCTGCCTTTGCGGATATCGGATCCTAAACCGAACTCGAACCACGGTAAGCT
ATTTCGCTAACAATTTCTTGATAAACGAAGAACAAGAAGAACCACAGCCTGAAGAAGTAG
CTGCATTTGCCTCGAGAAGAGAATTTCCAGAGACATAGAATAAGATCTGGGTATTACC
GenBank Accession BZ383376 [GenBank]
Graphic View Graphic view of gene At1g62950
Predicted Position of Insertion Chr1:23315309 - go to primer design
BLAST e Value 2e-63
Hit Clone Code (BAC ID) F16P17
Hit Gene Code At1g62950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation leucine-rich repeat transmembrane protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37