DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_134490c |
| Line Availability | available from NASC (N669089) and ABRC (SALK_134490c) |
| Confirmed for Hit | At1g03340 |
| Parent of DUPLO pair | 12741 |
| Parent of pair(s) | none |
Gene hit At1g03340
| Sequence (A. th genome BLAST matches underlined) | TGGTATGTGACTTTGATCAAATAACAGTTGAAT |
| GenBank Accession | BZ383784 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr1:820076 - go to primer design |
| BLAST e Value | 2e-06 |
| Hit Clone Code (BAC ID) | F15K9 |
| Hit Gene Code | At1g03340 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | hypothetical protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 