DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_138829 |
| Line Availability | available from NASC (N638829) and ABRC (SALK_138829) |
| Confirmed for Hit | At3g19300 |
| Parent of DUPLO pair | 2660 |
| Parent of pair(s) | none |
Gene hit At3g19300
| Sequence (A. th genome BLAST matches underlined) | GCACATTAAAGAAGCAGCTAGCTAGTTCAAGAGCCGATGAATTGTCAACCCGGCTTGCTA ACACAGCATAAGTTGCATCACGACAAGTACTCAGTTTGATGCTATTATCAGCACCAACGA GGCTCCTAAGGTAGCTGATACTGGAATT |
| GenBank Accession | BZ767412 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr3:6692302 - go to primer design |
| BLAST e Value | 5e-79 |
| Hit Clone Code (BAC ID) | MLD14 |
| Hit Gene Code | At3g19300 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Protein kinase superfamily protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |




gabi-kat.de 