DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_003192
Line Availability available from NASC (N503192) and ABRC (SALK_003192)
Confirmed for Hit At3g13970
Parent of DUPLO pair 12898
Parent of pair(s) none

Gene hit At3g13970

 
Sequence (A. th genome BLAST matches underlined) 
ATATCGATAAATGATTTCGAATGAGTCAGAGCGAAGCTGCCGACCCAGAAAATCGATCTC
GTTAGCAAACTGGCCGCTCCCTGTATCCTGAACTCTCCACAGCAGGGCCCATATATAACT
GAGCTAATAGTCATAAGATCAACACTAATTACAAAGCTAATGATTATGATGTTGACTAAT
GCCTAGTTCTAGGTGGTCACTAGACAATGCTTAACGAAGTTTCCT
GenBank Accession BH746837 [GenBank]
Graphic View Graphic view of gene At3g13970
Predicted Position of Insertion Chr3:4614038 - go to primer design
BLAST e Value 2e-48
Hit Clone Code (BAC ID) MDC16
Hit Gene Code At3g13970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ubiquitin-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED593049 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37