DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_008956c
Line Availability available from NASC (N661423) and ABRC (SALK_008956c)
Confirmed for Hit At2g21300
Parent of DUPLO pair 2576
Parent of pair(s) none

Gene hit At2g21300

 
Sequence (A. th genome BLAST matches underlined) 
TATAGAGATCTACGATGATGTCATCCGCGAGCTTCTCAGCCCAGATAGTACACCACTGAG
GCTACGAGATGACCCTGAGGTGAAAGATTTTTTTTTCTCTCCTTACTGCGAGCTCTTTTT
GGTAATAATGTTGTGTGACTCTCTTCT
GenBank Accession BH747028 [GenBank]
Graphic View Graphic view of gene At2g21300
Predicted Position of Insertion Chr2:9117480 - go to primer design
BLAST e Value 6e-48
Hit Clone Code (BAC ID) F3K23
Hit Gene Code At2g21300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATP binding microtubule motor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED609840 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37