DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_010839c
Line Availability available from NASC (N673806) and ABRC (SALK_010839c)
Confirmed for Hit At3g04120
Parent of DUPLO pair none
Parent of pair(s) 2378

Gene hit At3g04120

 
Sequence (A. th genome BLAST matches underlined)
TCATCCTCTGTGTATCCAAGGATTCCCTTGAGTTTGCCTTCGGATTCCTCCCTATGTATT
GGTGGTAAAAACACTTGGTGAGTAATTTGATCACTACTGGAATATAAGTAAACTTAATCT
GTCATTGCTCAAAAGCT
GenBank Accession ED571745 [GenBank]
Graphic View Graphic view of gene At3g04120
Predicted Position of Insertion Chr3:1082965 - go to primer design
BLAST e Value 4e-70
Hit Clone Code (BAC ID) T6K12
Hit Gene Code At3g04120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glyceraldehyde-3-phosphate dehydrogenase C subunit 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37