DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_012424c |
| Line Availability | available from NASC (N660306) and ABRC (SALK_012424c) |
| Confirmed for Hit | At2g20430 |
| Parent of DUPLO pair | 12187 |
| Parent of pair(s) | none |
Gene hit At2g20430
| Sequence (A. th genome BLAST matches underlined) | TATATATGACCTCGTAGATTTGAGTCAAGTATTAA |
| GenBank Accession | ED572992 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr2:8809196 - go to primer design |
| BLAST e Value | 2e-12 |
| Hit Clone Code (BAC ID) | F11A3 |
| Hit Gene Code | At2g20430 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | ROP-interactive CRIB motif-containing protein 6 |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | BH747199 [GenBank] ED572992 [GenBank] |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 