DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_012997c |
| Line Availability | available from NASC (N661529) and ABRC (SALK_012997c) |
| Confirmed for Hit | At1g62300 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 1463 |
Gene hit At1g62300
| Sequence (A. th genome BLAST matches underlined) | TGTAACTGTTGCTAACTTGTGTAAGCAATTCTCTAAGCT |
| GenBank Accession | ED573345 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr1:23018301 - go to primer design |
| BLAST e Value | 1e-14 |
| Hit Clone Code (BAC ID) | F19K23 |
| Hit Gene Code | At1g62300 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | WRKY family transcription factor |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | ED573345 [GenBank] |
|
Last Updated on Thursday, 10 June 2021 13:37 |




gabi-kat.de 