DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_015380
Line Availability available from NASC (N515380) and ABRC (SALK_015380)
Confirmed for Hit At5g52430
Parent of DUPLO pair 2337
Parent of pair(s) none

Gene hit At5g52430

 
Sequence (A. th genome BLAST matches underlined) 
AAATTAAAATGACATCTCTTCTTCTTCTTCCTCATTACCAAAGACAGAGATATAAAACCC
TATAAGTAACAAACCTTGAACATGGATCGTGAAAAAAGGTAAGAGATTTGGGTTCTAACA
ACTTATACACACTGAATAAATAAGCT
GenBank Accession ED575327 [GenBank]
Graphic View Graphic view of gene At5g52430
Predicted Position of Insertion Chr5:21283090 - go to primer design
BLAST e Value 8e-78
Hit Clone Code (BAC ID) K24M7
Hit Gene Code At5g52430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hydroxyproline-rich glycoprotein family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37