DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_019407
Line Availability available from NASC (N519407) and ABRC (SALK_019407)
Confirmed for Hit At4g16420
Parent of DUPLO pair 2346
Parent of pair(s) none

Gene hit At4g16420

 
Sequence (A. th genome BLAST matches underlined) 
AGAGAGCGATACTCCTGAATAACATGAACTGAAGCTGCGCGTGTTGCGTATCTATTCAGA
AAGGCACAACACTTAAGATCAGAAGGGCGAACCAGTCGCTTCTTTTTG
GenBank Accession BH758437 [GenBank]
Graphic View Graphic view of gene At4g16420
Predicted Position of Insertion Chr4:9263744 - go to primer design
BLAST e Value 5e-26
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g16420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ADA2 2B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37